GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 03:46:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_004311999             330 bp    RNA     linear   MAM 19-FEB-2020
DEFINITION  PREDICTED: Camelus ferus uncharacterized LOC116657067
            (LOC116657067), ncRNA.
ACCESSION   XR_004311999
VERSION     XR_004311999.1
DBLINK      BioProject: PRJNA605179
KEYWORDS    RefSeq.
SOURCE      Camelus ferus (Wild Bactrian camel)
  ORGANISM  Camelus ferus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Tylopoda;
            Camelidae; Camelus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045712.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Camelus ferus Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..330
                     /organism="Camelus ferus"
                     /mol_type="transcribed RNA"
                     /isolate="YT-003-E"
                     /db_xref="taxon:419612"
                     /chromosome="17"
                     /sex="male"
                     /tissue_type="ear skin"
                     /country="Mongolia"
     gene            1..330
                     /gene="LOC116657067"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:116657067"
     ncRNA           1..330
                     /ncRNA_class="lncRNA"
                     /gene="LOC116657067"
                     /product="uncharacterized LOC116657067"
                     /db_xref="GeneID:116657067"
ORIGIN      
accacatcacaaacaaaagtcctaataaaagtcgctgactaggactatcctcgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtacacatgaaagagatgtatttgctcagggtctatcaatcttgttctgcctgttttctcaagtcagcagccttatctttacatttactccactcaatctcttcttgtcattttccctttctgtctgaaaataactacccccaagtctgcaaagcatcatctttgtattccatttcttgttgtaaagagtttgtgacattctgcgagatggacatgctagatcggaagagca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]