2024-05-18 03:31:29, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001368356 2085 bp mRNA linear ROD 08-AUG-2023 DEFINITION Mus musculus double C2, alpha (Doc2a), transcript variant 3, mRNA. ACCESSION NM_001368356 XM_017321970 VERSION NM_001368356.2 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 2085) AUTHORS Wang QW, Qin J, Chen YF, Tu Y, Xing YY, Wang Y, Yang LY, Lu SY, Geng L, Shi W, Yang Y and Yao J. TITLE 16p11.2 CNV gene Doc2alpha functions in neurodevelopment and social behaviors through interaction with Secretagogin JOURNAL Cell Rep 42 (7), 112691 (2023) PUBMED 37354460 REMARK GeneRIF: 16p11.2 CNV gene Doc2alpha functions in neurodevelopment and social behaviors through interaction with Secretagogin. REFERENCE 2 (bases 1 to 2085) AUTHORS Bourgeois-Jaarsma Q, Miaja Hernandez P and Groffen AJ. TITLE Ca2+ sensor proteins in spontaneous release and synaptic plasticity: Limited contribution of Doc2c, rabphilin-3a and synaptotagmin 7 in hippocampal glutamatergic neurons JOURNAL Mol Cell Neurosci 112, 103613 (2021) PUBMED 33753311 REMARK GeneRIF: Ca(2+) sensor proteins in spontaneous release and synaptic plasticity: Limited contribution of Doc2c, rabphilin-3a and synaptotagmin 7 in hippocampal glutamatergic neurons. REFERENCE 3 (bases 1 to 2085) AUTHORS Diez-Arazola R, Meijer M, Bourgeois-Jaarsma Q, Cornelisse LN, Verhage M and Groffen AJ. TITLE Doc2 Proteins Are Not Required for the Increased Spontaneous Release Rate in Synaptotagmin-1-Deficient Neurons JOURNAL J Neurosci 40 (13), 2606-2617 (2020) PUBMED 32098902 REMARK GeneRIF: Doc2 Proteins Are Not Required for the Increased Spontaneous Release Rate in Synaptotagmin-1-Deficient Neurons. REFERENCE 4 (bases 1 to 2085) AUTHORS Bourgeois-Jaarsma Q, Verhage M and Groffen AJ. TITLE Doc2b Ca2+ binding site mutants enhance synaptic release at rest at the expense of sustained synaptic strength JOURNAL Sci Rep 9 (1), 14408 (2019) PUBMED 31594980 REMARK GeneRIF: Doc2b Ca(2+) binding site mutants enhance synaptic release at rest at the expense of sustained synaptic strength. Publication Status: Online-Only REFERENCE 5 (bases 1 to 2085) AUTHORS Courtney NA, Briguglio JS, Bradberry MM, Greer C and Chapman ER. TITLE Excitatory and Inhibitory Neurons Utilize Different Ca2+ Sensors and Sources to Regulate Spontaneous Release JOURNAL Neuron 98 (5), 977-991 (2018) PUBMED 29754754 REMARK GeneRIF: Doc2alpha promoted glutamatergic spontaneous neurotransmitter release, while Doc2beta and syt1 both regulated GABAergic spontaneous neurotransmitter release. REFERENCE 6 (bases 1 to 2085) AUTHORS Groffen AJ, Friedrich R, Brian EC, Ashery U and Verhage M. TITLE DOC2A and DOC2B are sensors for neuronal activity with unique calcium-dependent and kinetic properties JOURNAL J Neurochem 97 (3), 818-833 (2006) PUBMED 16515538 REFERENCE 7 (bases 1 to 2085) AUTHORS Toonen RF, de Vries KJ, Zalm R, Sudhof TC and Verhage M. TITLE Munc18-1 stabilizes syntaxin 1, but is not essential for syntaxin 1 targeting and SNARE complex formation JOURNAL J Neurochem 93 (6), 1393-1400 (2005) PUBMED 15935055 REFERENCE 8 (bases 1 to 2085) AUTHORS Bouwman J, Maia AS, Camoletto PG, Posthuma G, Roubos EW, Oorschot VM, Klumperman J and Verhage M. TITLE Quantification of synapse formation and maintenance in vivo in the absence of synaptic release JOURNAL Neuroscience 126 (1), 115-126 (2004) PUBMED 15145078 REFERENCE 9 (bases 1 to 2085) AUTHORS Sakaguchi G, Manabe T, Kobayashi K, Orita S, Sasaki T, Naito A, Maeda M, Igarashi H, Katsuura G, Nishioka H, Mizoguchi A, Itohara S, Takahashi T and Takai Y. TITLE Doc2alpha is an activity-dependent modulator of excitatory synaptic transmission JOURNAL Eur J Neurosci 11 (12), 4262-4268 (1999) PUBMED 10594652 REFERENCE 10 (bases 1 to 2085) AUTHORS Naito A, Orita S, Wanaka A, Sasaki T, Sakaguchi G, Maeda M, Igarashi H, Tohyama M and Takai Y. TITLE Molecular cloning of mouse Doc2alpha and distribution of its mRNA in adult mouse brain JOURNAL Brain Res Mol Brain Res 44 (2), 198-204 (1997) PUBMED 9073161 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC124505.4. On Sep 28, 2022 this sequence version replaced NM_001368356.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: SRR7652917.914571.1, SRR7345562.2794193.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849384, SAMN01164131 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-119 AC124505.4 188682-188800 120-475 AC124505.4 189275-189630 476-555 AC124505.4 189988-190067 556-630 AC124505.4 190250-190324 631-740 AC124505.4 190430-190539 741-867 AC124505.4 191702-191828 868-927 AC124505.4 191908-191967 928-1091 AC124505.4 192051-192214 1092-1173 AC124505.4 192305-192386 1174-1270 AC124505.4 192477-192573 1271-2085 AC124505.4 192659-193473 FEATURES Location/Qualifiers source 1..2085 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="7" /map="7 69.25 cM" gene 1..2085 /gene="Doc2a" /note="double C2, alpha" /db_xref="GeneID:13446" /db_xref="MGI:MGI:109446" exon 1..119 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 120..475 /gene="Doc2a" /inference="alignment:Splign:2.1.0" misc_feature 133..135 /gene="Doc2a" /note="upstream in-frame stop codon" CDS 199..1416 /gene="Doc2a" /note="doc2-alpha" /codon_start=1 /product="double C2-like domain-containing protein alpha" /protein_id="NP_001355285.1" /db_xref="CCDS:CCDS21847.1" /db_xref="GeneID:13446" /db_xref="MGI:MGI:109446" /translation="
MRGRRGDRMTINIQEHMAINVCPGPIRPIRQISDYFPRRGPGPEGGGGGGGTGCGEAPAHLAPLALAPPAALLGATTPDDGAEVDSYDSDDTTALGTLEFDLLYDQASCMLHCRILRAKGLKPMDFNGLADPYVKLHLLPGACKANKLKTKTQRNTLNPVWNEELTYSGITDDDITHKVLRISVCDEDKLSHNEFIGEIRVPLRRLKPSQKKHFNICLERQVPLPSPSSMSAALRGISCYLKELEQAEQGPGLLEERGRILLSLSYSSRRHGLLVGIVRCAHLAAMDVNGYSDPYVKTYLRPDVDKKSKHKTCVKKKTLNPEFNEEFFYEIELSTLATKTLEVTVWDYDIGKSNDFIGGVSLGPGARGEAQKHWNDCLHQPDTALERWHTLTSELPPAAGAYPLA"
misc_feature 199..480 /gene="Doc2a" /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1); Region: Interaction with UNC13D and DYNLT1. /evidence=ECO:0000250" misc_feature 298..360 /gene="Doc2a" /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 481..852 /gene="Doc2a" /note="C2 domain first repeat present in Rabphilin and Double C2 domain; Region: C2A_Rabphilin_Doc2; cd04035" /db_xref="CDD:176000" misc_feature order(571..573,589..591,754..756,760..762,778..780) /gene="Doc2a" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:176000" misc_feature 856..1413 /gene="Doc2a" /note="propagated from UniProtKB/Swiss-Prot (Q7TNF0.1); Region: Interaction with UNC13D. /evidence=ECO:0000250" misc_feature 973..1371 /gene="Doc2a" /note="C2 domain second repeat present in Rabphilin and Double C2 domain; Region: C2B_Rabphilin_Doc2; cd08384" /db_xref="CDD:176030" misc_feature order(1057..1059,1075..1077,1237..1239,1243..1245, 1261..1263) /gene="Doc2a" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:176030" exon 476..555 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 556..630 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 631..740 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 741..867 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 868..927 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 928..1091 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 1092..1173 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 1174..1270 /gene="Doc2a" /inference="alignment:Splign:2.1.0" exon 1271..2085 /gene="Doc2a" /inference="alignment:Splign:2.1.0" ORIGIN
actcccgccccgcgccgcttctcgctcggtcctcgcccgccgcgccgcagtcgccgccgccgcccagcctgcgcccacgggccgcccgtgccgggcacctgttggaggctcagggacaggaagggagggcagtgaggttcctacagaccccagccggccactccagctctacacccgtctcccagtcagaggtgctgcatgaggggccgcaggggcgatcgcatgaccatcaacatccaggagcacatggccatcaacgtgtgccctggacccatcaggcccatccgccagatctccgactacttccctcgcagggggccaggaccagagggtggcggcggcggcggtggcacgggctgcggggaagccccagctcatctggcccctctggctctggccccccctgcggctctccttggggccactacacccgacgatggagctgaggtagacagctacgactcggatgataccaccgccctgggcacactggaatttgaccttctctatgatcaggcttcctgcatgctgcactgtagaatcctcagggccaagggcctcaagcccatggatttcaatggcctggctgacccctatgtaaagcttcacctcctgccaggagcctgcaaggccaataagctaaaaaccaagacacagaggaacacactgaaccctgtgtggaatgaggagctgacgtacagcgggatcacggatgatgacatcacccacaaggtgctcaggatctctgtctgtgatgaggacaagctgagccacaatgaattcattggggagatccgagtgcccctccgccgcctcaagccttcacagaagaagcattttaacatctgccttgagcgccaggtcccgcttccttcaccctcttcaatgtctgcggcgctgaggggcatatcctgttacctgaaggagctggagcaggcagagcagggacctgggctgctggaagagcgcgggcgcatcctgctgagcctcagctacagctctcggcggcatgggctgctggtgggcattgttcgctgtgcgcacctggctgcaatggatgttaacggctactctgacccttatgtgaagacgtacttgagaccagatgtggataagaaatccaagcacaaaacatgtgtaaagaagaagacactaaatccggaatttaatgaggaattcttctatgagattgaactctccactctggccactaagaccctggaggtcacagtctgggactacgacattggcaaatccaatgacttcataggtggtgtgtctctggggccaggagcccggggagaggcccagaaacactggaatgactgtctacatcagccggacacagccctggagcgctggcatactctgaccagcgagctgccccctgcagcaggggcttaccctttggcttgagtgaacagcagctgtccatcacaggccctctggggccgggtccagtacccaaccttcgcacgagtgtgttgcacgtttacatggggtgggatgcccctgccccacactacctgtcttatttttgtgagtctctgtgacgggcctgtcttcttgtgagggactgtggagagctatattcacatatgcaaacttcctcctgcctgccttgctgttacctgcaaatatgcaaccacccgtgcacagggccacgtgggagtctcctgccagtgccccaccccatcctgcagctcctttcttggcctttccaggctgcctggtcccctgccccacagggagggggtcggattagggaagattagaggaggacgtttccaaatagaggaaaggacaaggaaagaaagagccaactctttaatacagagccttcactaaatcccagccctgcgtagctgctcttctaaaggggcggccaccgtaggtctctacctcccgaagatgtagcagacccttttggccactcgtttaaataactgttccctggatggggctgggatgtaagggcaggaccctgccaccttcctcggggacattgtgcatgtttacgccttttctgattgtgtcagtggccgaagcatggcaactgggcatcaataaacatctcttgaggaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]